t(9;14)(q34;q32) EML1/ABL1

2005-07-01   Jean-Loup Huret  , Kim De Keersmaecker  

1.Department of Human Genetics, Flanders Interuniversity Institute for Biotechnology, Leuven, Belgium

Clinics and Pathology

Disease

T cell acute lymhoblastic leukemia (T-ALL)

Epidemiology

only 1 case to date: a 16 yr old female patient

Cytology

high leukocytosis with 99% blasts with the phenotype of cortical thymocytes

Prognosis

yet unknown; the patient was in complete remission at 15 mths+.

Cytogenetics

Cytogenetics morphological

cryptic translocation: the karyotype appeared normal

Cytogenetics molecular

FISH with 5¹ ABL1 probe (RP11-57C19) and 3¹ ABL1 probe (RP11-83J21) resulted in a split signal
Atlas Image
FISH with 5 ABL1 (green signal) and 3 ABL1 (red signal) probes on metaphase cells of the T-ALL patient with the cryptic t(9;14)(q34;q32). The translocation causes separation of the 2 probes with the 5 ABL1 probe hybridizing to der(9) and the 3 ABL1 probe hybridizing to der(14) - Kim De Keersmaecker.

Additional anomalies

Patient had also hemizygous deletion of CDKN2A and ectopic expression of TLX1

Genes Involved and Proteins

Gene name
ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1)
Location
9q34.12
Protein description
tyrosine kinase
Gene name
EML1 (echinoderm microtubule associated protein like 1)
Location
14q32.2
Note
gene was mapped within Usher syndrome type 1a locus
Protein description
protein is very similar to the echinoderm microtubule-associated protein

Result of the Chromosomal Anomaly

Description

5 EML1 - 3 ABL1, in frame fusion between exon 17 of EML1 and exon 2 of ABL1

Detection protocole

RT-PCR using the primers 5¹- cactcactgggaggtggttt and 5¹- acaccattccccattgtgattat
Atlas Image
Schematic representation of EML1 and ABL1 proteins. The EML1-ABL1 fusion protein generated after t(9;14)(q34;q32) is represented beneath. The sequence of the in-frame fusion between exon 17 of EML1 and exon 2 of ABL1 is indicated at the bottom, translation of the nucleotide sequence is shown beneath - Kim De Keersmaecker.

Description

190 kDa NH2 EML1 - COOH ABL1 fusion protein, contains the coiled-coil domain of EML1 and the kinase domain of ABL1.

Oncogenesis

Constitutive EML1-ABL1 tyrosine kinase activity causing deregulation of cellular survival and proliferation pathways

Highly cited references

Pubmed IDYearTitleCitations
317237602018EML1-ABL1 Is Activated by Coiled-Coil-Mediated Oligomerization and Induces T-Cell Acute Lymphoblastic Leukemia or Myeloproliferative Disease in a Mouse Bone Marrow Transplant Model.15
157138002005Fusion of EML1 to ABL1 in T-cell acute lymphoblastic leukemia with cryptic t(9;14)(q34;q32).0
214350022011ABL1 fusion genes in hematological malignancies: a review.0
170241112006Transition from EML1-ABL1 to NUP214-ABL1 positivity in a patient with acute T-lymphoblastic leukemia.0
200730702010ABL1 rearrangements in T-cell acute lymphoblastic leukemia.0
191660982008ABL1 fusions in T-cell acute lymphoblastic leukemia.0
257403112015Microtubule association of EML proteins and the EML4-ALK variant 3 oncoprotein require an N-terminal trimerization domain.0

Article Bibliography

Pubmed IDLast YearTitleAuthors
157138002005Fusion of EML1 to ABL1 in T-cell acute lymphoblastic leukemia with cryptic t(9;14)(q34;q32).De Keersmaecker K et al

Summary

Fusion gene

EML1/ABL1 EML1 (14q32.2) ABL1 (9q34.12) M|EML1/ABL1 EML1 (14q32.2) ABL1 (9q34.12) M t(9;14)(q34;q32)|EML1/ABL1 EML1 (14q32.2) ABL1 (9q34.12) TIC
Atlas Image
t(9;14)(q34;q32) G-banding and FISH - Courtesy Melanie Zenger and Claudia Haferlach.

Citation

Jean-Loup Huret ; Kim De Keersmaecker

t(9;14)(q34;q32) EML1/ABL1

Atlas Genet Cytogenet Oncol Haematol. 2005-07-01

Online version: http://atlasgeneticsoncology.org/haematological/1399/t(9;14)(q34;q32)-eml1-abl1