Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

t(9;14)(q34;q32)

Clinics and Pathology

Disease T cell acute lymhoblastic leukemia (T-ALL)
Epidemiology only 1 case to date: a 16 yr old female patient
Cytology high leukocytosis with 99% blasts with the phenotype of cortical thymocytes
Prognosis yet unknown; the patient was in complete remission at 15 mths+.

Cytogenetics

Cytogenetics Morphological cryptic translocation: the karyotype appeared normal
Cytogenetics Molecular FISH with 5¹ ABL1 probe (RP11-57C19) and 3¹ ABL1 probe (RP11-83J21) resulted in a split signal
 
  FISH with 5¹ ABL1 (green signal) and 3¹ ABL1 (red signal) probes on metaphase cells of the T-ALL patient with the cryptic t(9;14)(q34;q32). The translocation causes separation of the 2 probes with the 5¹ ABL1 probe hybridizing to der(9) and the 3¹ ABL1 probe hybridizing to der(14).
Probes RP11-57C19 and RP11-83J21 (BACPAC Resources, Oakland, CA)
Additional anomalies Patient had also hemizygous deletion of CDKN2A and ectopic expression of TLX1

Genes involved and Proteins

Gene Name ABL1
Location 9q34
Protein tyrosine kinase
Gene Name EML1
Location 14q32
Note gene was mapped within Usher syndrome type 1a locus
Protein protein is very similar to the echinoderm microtubule-associated protein

Result of the chromosomal anomaly

Hybrid gene
Description 5' EML1 - 3' ABL1, in frame fusion between exon 17 of EML1 and exon 2 of ABL1
Detection RT-PCR using the primers 5¹- cactcactgggaggtggttt and 5¹- acaccattccccattgtgattat
  
Fusion Protein
 
  Schematic representation of EML1 and ABL1 proteins. The EML1-ABL1 fusion protein generated after t(9;14)(q34;q32) is represented beneath. The sequence of the in-frame fusion between exon 17 of EML1 and exon 2 of ABL1 is indicated at the bottom, translation of the nucleotide sequence is shown beneath.
Description 190 kDa NH2 EML1 - COOH ABL1 fusion protein, contains the coiled-coil domain of EML1 and the kinase domain of ABL1.
Oncogenesis Constitutive EML1-ABL1 tyrosine kinase activity causing deregulation of cellular survival and proliferation pathways
  

External links

Other databaset(9;14)(q34;q32) Mitelman database (CGAP - NCBI)
Other databaset(9;14)(q34;q32) CancerChromosomes (NCBI)

To be noted

Additional cases are needed to delineate the epidemiology of this rare entity:
you are welcome to submit a paper to our new Case Report section.

Bibliography

Fusion of EML1 to ABL1 in T-cell acute lymphoblastic leukemia with cryptic t(9;14)(q34;q32).
De Keersmaecker K, Graux C, Odero MD, Mentens N, Somers R, Maertens J, Wlodarska I, Vandenberghe P, Hagemeijer A, Marynen P, Cools J
Blood. 2005 ; 105 (12) : 4849-4852.
PMID 15713800
 

Contributor(s)

Written07-2005Kim De Keersmaecker and Jean Loup Huret
Department of Human Genetics, Flanders Interuniversity Institute for Biotechnology, Leuven, Belgium

Citation

This paper should be referenced as such :
De Keersmaecker K, Huret JL . t(9;14)(q34;q32). Atlas Genet Cytogenet Oncol Haematol. July 2005 .
URL : http://AtlasGeneticsOncology.org/Genes/t0914q34q32ID1399.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Wed Sep 24 21:07:09 2008


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

j.l.huret@chu-poitiers.fr.