| Clinics and Pathology |
| Disease | T cell acute lymhoblastic leukemia (T-ALL) |
| Epidemiology | only 1 case to date: a 16 yr old female patient |
| Cytology | high leukocytosis with 99% blasts with the phenotype of cortical thymocytes |
| Prognosis | yet unknown; the patient was in complete remission at 15 mths+. |
| Cytogenetics |
| Cytogenetics Morphological | cryptic translocation: the karyotype appeared normal |
| Cytogenetics Molecular | FISH with 5¹ ABL1 probe (RP11-57C19) and 3¹ ABL1 probe (RP11-83J21) resulted in a split signal |
![]() | |
| FISH with 5¹ ABL1 (green signal) and 3¹ ABL1 (red signal) probes on metaphase cells of the T-ALL patient with the cryptic t(9;14)(q34;q32). The translocation causes separation of the 2 probes with the 5¹ ABL1 probe hybridizing to der(9) and the 3¹ ABL1 probe hybridizing to der(14). | |
| Probes | RP11-57C19 and RP11-83J21 (BACPAC Resources, Oakland, CA) |
| Additional anomalies | Patient had also hemizygous deletion of CDKN2A and ectopic expression of TLX1 |
| Genes involved and Proteins |
| Gene Name | ABL1 |
| Location | 9q34 |
| Protein | tyrosine kinase |
| Gene Name | EML1 |
| Location | 14q32 |
| Note | gene was mapped within Usher syndrome type 1a locus |
| Protein | protein is very similar to the echinoderm microtubule-associated protein |
| Result of the chromosomal anomaly |
| Description | 5' EML1 - 3' ABL1, in frame fusion between exon 17 of EML1 and exon 2 of ABL1 |
| Detection | RT-PCR using the primers 5¹- cactcactgggaggtggttt and 5¹- acaccattccccattgtgattat |
![]() | |
| Schematic representation of EML1 and ABL1 proteins. The EML1-ABL1 fusion protein generated after t(9;14)(q34;q32) is represented beneath. The sequence of the in-frame fusion between exon 17 of EML1 and exon 2 of ABL1 is indicated at the bottom, translation of the nucleotide sequence is shown beneath. | |
| Description | 190 kDa NH2 EML1 - COOH ABL1 fusion protein, contains the coiled-coil domain of EML1 and the kinase domain of ABL1. |
| Oncogenesis | Constitutive EML1-ABL1 tyrosine kinase activity causing deregulation of cellular survival and proliferation pathways |
| External links |
| Other database | t(9;14)(q34;q32) | Mitelman database (CGAP - NCBI) | |
| Other database | t(9;14)(q34;q32) | CancerChromosomes (NCBI) |
| To be noted |
| Additional cases are needed to delineate the epidemiology of this rare entity: you are welcome to submit a paper to our new Case Report section. |
| Bibliography |
| Fusion of EML1 to ABL1 in T-cell acute lymphoblastic leukemia with cryptic t(9;14)(q34;q32). |
| De Keersmaecker K, Graux C, Odero MD, Mentens N, Somers R, Maertens J, Wlodarska I, Vandenberghe P, Hagemeijer A, Marynen P, Cools J |
| Blood. 2005 ; 105 (12) : 4849-4852. |
| PMID 15713800 |
| Contributor(s) |
| Written | 07-2005 | Kim De Keersmaecker and Jean Loup Huret |
| Department of Human Genetics, Flanders Interuniversity Institute for Biotechnology, Leuven, Belgium |
| Citation |
| This paper should be referenced as such : |
| De Keersmaecker K, Huret JL . t(9;14)(q34;q32). Atlas Genet Cytogenet Oncol Haematol. July 2005 . URL : http://AtlasGeneticsOncology.org/Anomalies/t0914q34q32ID1399.html |
| © Atlas of Genetics and Cytogenetics in Oncology and Haematology | indexed on : Sat Feb 6 15:46:09 CET 2010 |
For comments and suggestions or contributions, please contact us